- Functional Analysis of the Cathepsin-Like Cysteine
Protease Genes in Adult Brugia malayi Using RNA
Interference
siRNA database used to get predicted siRNA of three transcripts.
- Comparative genomics and proteomics to study
tissue-specific response and function in natural
Mycobacterium bovis infections
Naranjo V, C Gortazar, M Villar, and J Fuente. Animal Health Res Rev 1: 81–88. Protein Lounge reference database used to determine protein ontology.
- Copy number variants and infantile spasms: evidence
for abnormalities in ventral forebrain development and
pathways of synaptic function
Paciorkowski AR et al. Euro J of Hum Gen 19: 1238–1245. Pathway Builder used for illustration of the GABA-receptor subunit genes expressed in the post-synapse with abnormal copy number in subjects with ISS identified in this study (Fig 2B).
- Proteomic and transcriptomic analyses of differential
stress/inflammatory responses in mandibular lymph
nodes and oropharyngeal tonsils of European wild boars
naturally infected with Mycobacterium bovis
Naranjo V et al. Proteomics 7: 220–231. Protein reference database used to determine protein ontology.
- The Neuroproteomics of Schizophrenia
English JA, K Pennington, MJ Dunn, and DR Cotter. Biol Psych 69:163–172. Protein lounge is listed as a core facility for proteomic analysis.
- Modulation of the growth hormone-insulin-like growth
factor (GH-IGF) axis by pharmaceutical, nutraceutical
and environmental xenobiotics: An emerging role for
xenobiotic-metabolizing enzymes and the transcription
factors regulating their expression. A review
Scarth JP. Xenobiotica 36: 119-218. Protein Lounge mentioned as having particularly good diagrams of GH, the IGFs, and Insulin.
- A Fission Yeast-Based Platform for Phosphodiesterase Inhibitor HTSs and Analyses of Phosphodiesterase Activity
Demirbas D, O Ceyhan, AR Wyman, and CS Hoffman. Phosphodiesterases as Drug Targets, Handbook of Experimental Pharmacology 204. Pathway Builder used to make S. Pombe glucose/cAMP signaling pathway (Fig 1).
- Ectopic expression of CD74 in Ikkˇ-deleted mouse hepatocytes
Koch KS and HL Leffert. Acta Histochemica 113: 428–435. Used Protein Lounge database to normalize and group RNA data.
- REGULATION AND TRAFFICKING OF THE IRON EXPORT PROTEIN,
FERROPORTIN1, IN MYCOBACTERIUM TUBERCULOSIS-INFECTED
MACROPHAGES
Van Zandt KE. Dissertation. A siRNA target sequence (aagcaagcgtaatctccaggga, 225-275) was identified in mouse STAT1 (NM-009283) using the Protein Lounge on-line siRNA Database.
- Reconstruction and Modeling of MAP Kinase signaling pathway
Compares Protein Lounge''s MAPK pathways with other databases.
- A Discrete Nash Theorem with Low Complexity and Dynamic Equilibria
Protein Lounge MAPK Pathway to help find 113 chemical reactions involved in the pathway.
- Sexual experience in female rodents: Cellular mechanisms and functional consequences
Pathway Builder used to make a schematic diagram of signaling pathways that could result in changes to cellular plasticity as a function of sexual experience.
Citations
Displaying 73 to 84 (of 134 Citations)
Displaying 73 to 84 (of 134 Citations)
